diff options
author | Russ Cox <rsc@golang.org> | 2010-02-25 16:01:29 -0800 |
---|---|---|
committer | Russ Cox <rsc@golang.org> | 2010-02-25 16:01:29 -0800 |
commit | 9750adbbadad547ef71cc5f0dbd6b80af7edef09 (patch) | |
tree | c6ab3b4ef4175de81b8c93de57907354a8de1418 | |
parent | dfaa6eaa76bb1d440a2e7f93fa2ee6da622f9d0d (diff) | |
download | go-9750adbbadad547ef71cc5f0dbd6b80af7edef09.tar.gz go-9750adbbadad547ef71cc5f0dbd6b80af7edef09.zip |
strings: delete Runes, Bytes
gofmt -w -r 'strings.Bytes(a) -> []byte(a)' src/cmd src/pkg test/bench
gofmt -w -r 'strings.Runes(a) -> []int(a)' src/cmd src/pkg test/bench
delete unused imports
R=r
CC=golang-dev
https://golang.org/cl/224062
65 files changed, 240 insertions, 311 deletions
diff --git a/src/cmd/cgo/gcc.go b/src/cmd/cgo/gcc.go index 01c4836841..fc2da37c17 100644 --- a/src/cmd/cgo/gcc.go +++ b/src/cmd/cgo/gcc.go @@ -724,7 +724,7 @@ func (c *typeConv) Opaque(n int64) ast.Expr { func (c *typeConv) intExpr(n int64) ast.Expr { return &ast.BasicLit{ Kind: token.INT, - Value: strings.Bytes(strconv.Itoa64(n)), + Value: []byte(strconv.Itoa64(n)), } } @@ -755,7 +755,7 @@ func (c *typeConv) Struct(dt *dwarf.StructType) (expr *ast.StructType, csyntax s used[f.Name] = true } for cid, goid := range ident { - if token.Lookup(strings.Bytes(goid)).IsKeyword() { + if token.Lookup([]byte(goid)).IsKeyword() { // Avoid keyword goid = "_" + goid diff --git a/src/cmd/ebnflint/ebnflint.go b/src/cmd/ebnflint/ebnflint.go index 9d391249d5..3dfa71f078 100644 --- a/src/cmd/ebnflint/ebnflint.go +++ b/src/cmd/ebnflint/ebnflint.go @@ -13,7 +13,6 @@ import ( "io/ioutil" "os" "path" - "strings" ) @@ -29,8 +28,8 @@ func usage() { // Markers around EBNF sections in .html files var ( - open = strings.Bytes(`<pre class="ebnf">`) - close = strings.Bytes(`</pre>`) + open = []byte(`<pre class="ebnf">`) + close = []byte(`</pre>`) ) diff --git a/src/cmd/godoc/godoc.go b/src/cmd/godoc/godoc.go index 98cac945fe..29792d58f7 100644 --- a/src/cmd/godoc/godoc.go +++ b/src/cmd/godoc/godoc.go @@ -152,7 +152,7 @@ func pkgName(filename string) string { func htmlEscape(s string) string { var buf bytes.Buffer - template.HTMLEscape(&buf, strings.Bytes(s)) + template.HTMLEscape(&buf, []byte(s)) return buf.String() } @@ -476,7 +476,7 @@ func (s *Styler) BasicLit(x *ast.BasicLit) (text []byte, tag printer.HTMLTag) { func (s *Styler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) { - text = strings.Bytes(id.Name()) + text = []byte(id.Name()) if s.highlight == id.Name() { tag = printer.HTMLTag{"<span class=highlight>", "</span>"} } @@ -485,7 +485,7 @@ func (s *Styler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) { func (s *Styler) Token(tok token.Token) (text []byte, tag printer.HTMLTag) { - text = strings.Bytes(tok.String()) + text = []byte(tok.String()) return } @@ -493,7 +493,7 @@ func (s *Styler) Token(tok token.Token) (text []byte, tag printer.HTMLTag) { // ---------------------------------------------------------------------------- // Tab conversion -var spaces = strings.Bytes(" ") // 16 spaces seems like a good number +var spaces = []byte(" ") // 16 spaces seems like a good number const ( indenting = iota @@ -595,7 +595,7 @@ func writeAny(w io.Writer, x interface{}, html bool) { case []byte: writeText(w, v, html) case string: - writeText(w, strings.Bytes(v), html) + writeText(w, []byte(v), html) case ast.Decl, ast.Expr, ast.Stmt, *ast.File: writeNode(w, x, html, &defaultStyler) default: @@ -674,13 +674,13 @@ func urlFmt(w io.Writer, x interface{}, format string) { if strings.HasPrefix(relpath, "src/pkg/") { relpath = relpath[len("src/pkg/"):] } - template.HTMLEscape(w, strings.Bytes(pkgHandler.pattern+relpath)) + template.HTMLEscape(w, []byte(pkgHandler.pattern+relpath)) case "url-src": - template.HTMLEscape(w, strings.Bytes("/"+relpath)) + template.HTMLEscape(w, []byte("/"+relpath)) case "url-pos": // line id's in html-printed source are of the // form "L%d" where %d stands for the line number - template.HTMLEscape(w, strings.Bytes("/"+relpath)) + template.HTMLEscape(w, []byte("/"+relpath)) fmt.Fprintf(w, "#L%d", line) } } @@ -742,7 +742,7 @@ func paddingFmt(w io.Writer, x interface{}, format string) { // Template formatter for "time" format. func timeFmt(w io.Writer, x interface{}, format string) { // note: os.Dir.Mtime_ns is in uint64 in ns! - template.HTMLEscape(w, strings.Bytes(time.SecondsToLocalTime(int64(x.(uint64)/1e9)).String())) + template.HTMLEscape(w, []byte(time.SecondsToLocalTime(int64(x.(uint64)/1e9)).String())) } @@ -757,7 +757,7 @@ func dirslashFmt(w io.Writer, x interface{}, format string) { // Template formatter for "localname" format. func localnameFmt(w io.Writer, x interface{}, format string) { _, localname := pathutil.Split(x.(string)) - template.HTMLEscape(w, strings.Bytes(localname)) + template.HTMLEscape(w, []byte(localname)) } @@ -852,8 +852,8 @@ func serveText(c *http.Conn, text []byte) { // Files var ( - tagBegin = strings.Bytes("<!--") - tagEnd = strings.Bytes("-->") + tagBegin = []byte("<!--") + tagEnd = []byte("-->") ) // commentText returns the text of the first HTML comment in src. @@ -878,7 +878,7 @@ func serveHTMLDoc(c *http.Conn, r *http.Request, abspath, relpath string) { // if it begins with "<!DOCTYPE " assume it is standalone // html that doesn't need the template wrapping. - if bytes.HasPrefix(src, strings.Bytes("<!DOCTYPE ")) { + if bytes.HasPrefix(src, []byte("<!DOCTYPE ")) { c.Write(src) return } diff --git a/src/cmd/godoc/index.go b/src/cmd/godoc/index.go index dcad67a95a..01ec298781 100644 --- a/src/cmd/godoc/index.go +++ b/src/cmd/godoc/index.go @@ -696,7 +696,7 @@ func (x *Index) LookupWord(w string) (match *LookupResult, alt *AltWords) { func isIdentifier(s string) bool { var S scanner.Scanner - S.Init("", strings.Bytes(s), nil, 0) + S.Init("", []byte(s), nil, 0) if _, tok, _ := S.Scan(); tok == token.IDENT { _, tok, _ := S.Scan() return tok == token.EOF diff --git a/src/cmd/godoc/snippet.go b/src/cmd/godoc/snippet.go index 102878dc5c..d8fb195338 100755 --- a/src/cmd/godoc/snippet.go +++ b/src/cmd/godoc/snippet.go @@ -14,7 +14,6 @@ import ( "go/ast" "go/printer" "fmt" - "strings" ) @@ -36,7 +35,7 @@ func (s *snippetStyler) LineTag(line int) (text []uint8, tag printer.HTMLTag) { func (s *snippetStyler) Ident(id *ast.Ident) (text []byte, tag printer.HTMLTag) { - text = strings.Bytes(id.Name()) + text = []byte(id.Name()) if s.highlight == id { tag = printer.HTMLTag{"<span class=highlight>", "</span>"} } diff --git a/src/cmd/godoc/spec.go b/src/cmd/godoc/spec.go index 15f3cba20d..2298fae2ce 100644 --- a/src/cmd/godoc/spec.go +++ b/src/cmd/godoc/spec.go @@ -16,7 +16,6 @@ import ( "go/scanner" "go/token" "io" - "strings" ) @@ -166,8 +165,8 @@ func (p *ebnfParser) parse(out io.Writer, src []byte) { // Markers around EBNF sections var ( - openTag = strings.Bytes(`<pre class="ebnf">`) - closeTag = strings.Bytes(`</pre>`) + openTag = []byte(`<pre class="ebnf">`) + closeTag = []byte(`</pre>`) ) diff --git a/src/pkg/archive/tar/reader_test.go b/src/pkg/archive/tar/reader_test.go index 719e3d87ec..88eee11390 100644 --- a/src/pkg/archive/tar/reader_test.go +++ b/src/pkg/archive/tar/reader_test.go @@ -11,7 +11,6 @@ import ( "io" "os" "reflect" - "strings" "testing" ) @@ -161,7 +160,7 @@ func TestPartialRead(t *testing.T) { if _, err := io.ReadFull(tr, buf); err != nil { t.Fatalf("Unexpected error: %v", err) } - if expected := strings.Bytes("Kilt"); !bytes.Equal(buf, expected) { + if expected := []byte("Kilt"); !bytes.Equal(buf, expected) { t.Errorf("Contents = %v, want %v", buf, expected) } @@ -174,7 +173,7 @@ func TestPartialRead(t *testing.T) { if _, err := io.ReadFull(tr, buf); err != nil { t.Fatalf("Unexpected error: %v", err) } - if expected := strings.Bytes("Google"); !bytes.Equal(buf, expected) { + if expected := []byte("Google"); !bytes.Equal(buf, expected) { t.Errorf("Contents = %v, want %v", buf, expected) } } diff --git a/src/pkg/archive/tar/writer.go b/src/pkg/archive/tar/writer.go index 88f9c72bd1..e02695256e 100644 --- a/src/pkg/archive/tar/writer.go +++ b/src/pkg/archive/tar/writer.go @@ -11,7 +11,6 @@ import ( "io" "os" "strconv" - "strings" ) var ( @@ -72,7 +71,7 @@ func (tw *Writer) cString(b []byte, s string) { } return } - for i, ch := range strings.Bytes(s) { + for i, ch := range []byte(s) { b[i] = ch } if len(s) < len(b) { @@ -128,25 +127,25 @@ func (tw *Writer) WriteHeader(hdr *Header) os.Error { s := slicer(header) // TODO(dsymonds): handle names longer than 100 chars - copy(s.next(100), strings.Bytes(hdr.Name)) - - tw.octal(s.next(8), hdr.Mode) // 100:108 - tw.numeric(s.next(8), hdr.Uid) // 108:116 - tw.numeric(s.next(8), hdr.Gid) // 116:124 - tw.numeric(s.next(12), hdr.Size) // 124:136 - tw.numeric(s.next(12), hdr.Mtime) // 136:148 - s.next(8) // chksum (148:156) - s.next(1)[0] = hdr.Typeflag // 156:157 - s.next(100) // linkname (157:257) - copy(s.next(8), strings.Bytes("ustar\x0000")) // 257:265 - tw.cString(s.next(32), hdr.Uname) // 265:297 - tw.cString(s.next(32), hdr.Gname) // 297:329 - tw.numeric(s.next(8), hdr.Devmajor) // 329:337 - tw.numeric(s.next(8), hdr.Devminor) // 337:345 + copy(s.next(100), []byte(hdr.Name)) + + tw.octal(s.next(8), hdr.Mode) // 100:108 + tw.numeric(s.next(8), hdr.Uid) // 108:116 + tw.numeric(s.next(8), hdr.Gid) // 116:124 + tw.numeric(s.next(12), hdr.Size) // 124:136 + tw.numeric(s.next(12), hdr.Mtime) // 136:148 + s.next(8) // chksum (148:156) + s.next(1)[0] = hdr.Typeflag // 156:157 + s.next(100) // linkname (157:257) + copy(s.next(8), []byte("ustar\x0000")) // 257:265 + tw.cString(s.next(32), hdr.Uname) // 265:297 + tw.cString(s.next(32), hdr.Gname) // 297:329 + tw.numeric(s.next(8), hdr.Devmajor) // 329:337 + tw.numeric(s.next(8), hdr.Devminor) // 337:345 // Use the GNU magic instead of POSIX magic if we used any GNU extensions. if tw.usedBinary { - copy(header[257:265], strings.Bytes("ustar \x00")) + copy(header[257:265], []byte("ustar \x00")) } // The chksum field is terminated by a NUL and a space. diff --git a/src/pkg/asn1/asn1_test.go b/src/pkg/asn1/asn1_test.go index d5779d017b..bb380ca0b8 100644 --- a/src/pkg/asn1/asn1_test.go +++ b/src/pkg/asn1/asn1_test.go @@ -7,7 +7,6 @@ package asn1 import ( "bytes" "reflect" - "strings" "testing" "time" ) @@ -165,7 +164,7 @@ var timeTestData = []timeTest{ func TestTime(t *testing.T) { for i, test := range timeTestData { - ret, err := parseUTCTime(strings.Bytes(test.in)) + ret, err := parseUTCTime([]byte(test.in)) if (err == nil) != test.ok { t.Errorf("#%d: Incorrect error result (did fail? %v, expected: %v)", i, err == nil, test.ok) } diff --git a/src/pkg/asn1/marshal.go b/src/pkg/asn1/marshal.go index 0ee593ef8d..a8a1fb6986 100644 --- a/src/pkg/asn1/marshal.go +++ b/src/pkg/asn1/marshal.go @@ -10,7 +10,6 @@ import ( "io" "os" "reflect" - "strings" "time" ) @@ -209,7 +208,7 @@ func marshalObjectIdentifier(out *forkableWriter, oid []int) (err os.Error) { } func marshalPrintableString(out *forkableWriter, s string) (err os.Error) { - b := strings.Bytes(s) + b := []byte(s) for _, c := range b { if !isPrintable(c) { return StructuralError{"PrintableString contains invalid character"} @@ -221,7 +220,7 @@ func marshalPrintableString(out *forkableWriter, s string) (err os.Error) { } func marshalIA5String(out *forkableWriter, s string) (err os.Error) { - b := strings.Bytes(s) + b := []byte(s) for _, c := range b { if c > 127 { return StructuralError{"IA5String contains invalid character"} diff --git a/src/pkg/bufio/bufio_test.go b/src/pkg/bufio/bufio_test.go index 83152e9265..0ee8ce6b39 100644 --- a/src/pkg/bufio/bufio_test.go +++ b/src/pkg/bufio/bufio_test.go @@ -296,7 +296,7 @@ var errorWriterTests = []errorWriterTest{ func TestWriteErrors(t *testing.T) { for _, w := range errorWriterTests { buf := NewWriter(w) - _, e := buf.Write(strings.Bytes("hello world")) + _, e := buf.Write([]byte("hello world")) if e != nil { t.Errorf("Write hello to %v: %v", w, e) continue diff --git a/src/pkg/bytes/bytes_test.go b/src/pkg/bytes/bytes_test.go index 5a76813e99..51bed4e508 100644 --- a/src/pkg/bytes/bytes_test.go +++ b/src/pkg/bytes/bytes_test.go @@ -6,7 +6,6 @@ package bytes_test import ( . "bytes" - "strings" "testing" "unicode" ) @@ -60,8 +59,8 @@ var comparetests = []BinOpTest{ func TestCompare(t *testing.T) { for _, tt := range comparetests { - a := strings.Bytes(tt.a) - b := strings.Bytes(tt.b) + a := []byte(tt.a) + b := []byte(tt.b) cmp := Compare(a, b) eql := Equal(a, b) if cmp != tt.i { @@ -94,8 +93,8 @@ var indextests = []BinOpTest{ func TestIndex(t *testing.T) { for _, tt := range indextests { - a := strings.Bytes(tt.a) - b := strings.Bytes(tt.b) + a := []byte(tt.a) + b := []byte(tt.b) pos := Index(a, b) if pos != tt.i { t.Errorf(`Index(%q, %q) = %v`, tt.a, tt.b, pos) @@ -108,7 +107,7 @@ func TestIndexByte(t *testing.T) { if len(tt.b) != 1 { continue } - a := strings.Bytes(tt.a) + a := []byte(tt.a) b := tt.b[0] pos := IndexByte(a, b) if pos != tt.i { @@ -171,7 +170,7 @@ var explodetests = []ExplodeTest{ func TestExplode(t *testing.T) { for _, tt := range explodetests { - a := Split(strings.Bytes(tt.s), nil, tt.n) + a := Split([]byte(tt.s), nil, tt.n) result := arrayOfString(a) if !eq(result, tt.a) { t.Errorf(`Explode("%s", %d) = %v; want %v`, tt.s, tt.n, result, tt.a) @@ -210,13 +209,13 @@ var splittests = []SplitTest{ func TestSplit(t *testing.T) { for _, tt := range splittests { - a := Split(strings.Bytes(tt.s), strings.Bytes(tt.sep), tt.n) + a := Split([]byte(tt.s), []byte(tt.sep), tt.n) result := arrayOfString(a) if !eq(result, tt.a) { t.Errorf(`Split(%q, %q, %d) = %v; want %v`, tt.s, tt.sep, tt.n, result, tt.a) continue } - s := Join(a, strings.Bytes(tt.sep)) + s := Join(a, []byte(tt.sep)) if string(s) != tt.s { t.Errorf(`Join(Split(%q, %q, %d), %q) = %q`, tt.s, tt.sep, tt.n, tt.sep, s) } @@ -241,7 +240,7 @@ var splitaftertests = []SplitTest{ func TestSplitAfter(t *testing.T) { for _, tt := range splitaftertests { - a := SplitAfter(strings.Bytes(tt.s), strings.Bytes(tt.sep), tt.n) + a := SplitAfter([]byte(tt.s), []byte(tt.sep), tt.n) result := arrayOfString(a) if !eq(result, tt.a) { t.Errorf(`Split(%q, %q, %d) = %v; want %v`, tt.s, tt.sep, tt.n, result, tt.a) @@ -275,7 +274,7 @@ var fieldstests = []FieldsTest{ func TestFields(t *testing.T) { for _, tt := range fieldstests { - a := Fields(strings.Bytes(tt.s)) + a := Fields([]byte(tt.s)) result := arrayOfString(a) if !eq(result, tt.a) { t.Errorf("Fields(%q) = %v; want %v", tt.s, a, tt.a) @@ -434,7 +433,7 @@ func TestAdd(t *testing.T) { for i := 0; i < len(test.s); i++ { b[i] = test.s[i] } - b = Add(b, strings.Bytes(test.t)) + b = Add(b, []byte(test.t)) if string(b) != test.s+test.t { t.Errorf("Add(%q,%q) = %q", test.s, test.t, string(b)) } @@ -474,8 +473,8 @@ var RepeatTests = []RepeatTest{ func TestRepeat(t *testing.T) { for _, tt := range RepeatTests { - tin := strings.Bytes(tt.in) - tout := strings.Bytes(tt.out) + tin := []byte(tt.in) + tout := []byte(tt.out) a := Repeat(tin, tt.count) if !Equal(a, tout) { t.Errorf("Repeat(%q, %d) = %q; want %q", tin, tt.count, a, tout) @@ -514,7 +513,7 @@ var RunesTests = []RunesTest{ func TestRunes(t *testing.T) { for _, tt := range RunesTests { - tin := strings.Bytes(tt.in) + tin := []byte(tt.in) a := Runes(tin) if !runesEqual(a, tt.out) { t.Errorf("Runes(%q) = %v; want %v", tin, a, tt.out) diff --git a/src/pkg/compress/gzip/gzip_test.go b/src/pkg/compress/gzip/gzip_test.go index 3a9843fd59..60c9f43dbb 100644 --- a/src/pkg/compress/gzip/gzip_test.go +++ b/src/pkg/compress/gzip/gzip_test.go @@ -7,7 +7,6 @@ package gzip import ( "io" "io/ioutil" - "strings" "testing" ) @@ -53,10 +52,10 @@ func TestWriter(t *testing.T) { pipe(t, func(deflater *Deflater) { deflater.Comment = "comment" - deflater.Extra = strings.Bytes("extra") + deflater.Extra = []byte("extra") deflater.Mtime = 1e8 deflater.Name = "name" - _, err := deflater.Write(strings.Bytes("payload")) + _, err := deflater.Write([]byte("payload")) if err != nil { t.Fatalf("%v", err) } diff --git a/src/pkg/crypto/hmac/hmac_test.go b/src/pkg/crypto/hmac/hmac_test.go index 98e32df016..d867c83a96 100644 --- a/src/pkg/crypto/hmac/hmac_test.go +++ b/src/pkg/crypto/hmac/hmac_test.go @@ -7,7 +7,6 @@ package hmac import ( "hash" "fmt" - "strings" "testing" ) @@ -33,7 +32,7 @@ var hmacTests = []hmacTest{ 0x30, 0x31, 0x32, 0x33, 0x34, 0x35, 0x36, 0x37, 0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f, }, - strings.Bytes("Sample #1"), + []byte("Sample #1"), "4f4ca3d5d68ba7cc0a1208c9c61e9c5da0403c0a", }, hmacTest{ @@ -43,7 +42,7 @@ var hmacTests = []hmacTest{ 0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f, 0x40, 0x41, 0x42, 0x43, }, - strings.Bytes("Sample #2"), + []byte("Sample #2"), "0922d3405faa3d194f82a45830737d5cc6c75d24", }, hmacTest{ @@ -63,15 +62,15 @@ var hmacTests = []hmacTest{ 0xa8, 0xa9, 0xaa, 0xab, 0xac, 0xad, 0xae, 0xaf, 0xb0, 0xb1, 0xb2, 0xb3, }, - strings.Bytes("Sample #3"), + []byte("Sample #3"), "bcf41eab8bb2d802f3d05caf7cb092ecf8d1a3aa", }, // Test from Plan 9. hmacTest{ NewMD5, - strings.Bytes("Jefe"), - strings.Bytes("what do ya want for nothing?"), + []byte("Jefe"), + []byte("what do ya want for nothing?"), "750c783e6ab0b503eaa86e310a5db738", }, } diff --git a/src/pkg/crypto/rsa/pkcs1v15_test.go b/src/pkg/crypto/rsa/pkcs1v15_test.go index 6bdd648765..69edeaa2ee 100644 --- a/src/pkg/crypto/rsa/pkcs1v15_test.go +++ b/src/pkg/crypto/rsa/pkcs1v15_test.go @@ -12,14 +12,13 @@ import ( "encoding/hex" "os" "io" - "strings" "testing" "testing/quick" ) func decodeBase64(in string) []byte { out := make([]byte, base64.StdEncoding.DecodedLen(len(in))) - n, err := base64.StdEncoding.Decode(out, strings.Bytes(in)) + n, err := base64.StdEncoding.Decode(out, []byte(in)) if err != nil { return nil } @@ -56,7 +55,7 @@ func TestDecryptPKCS1v15(t *testing.T) { if err != nil { t.Errorf("#%d error decrypting", i) } - want := strings.Bytes(test.out) + want := []byte(test.out) if bytes.Compare(out, want) != 0 { t.Errorf("#%d got:%#v want:%#v", i, out, want) } @@ -125,12 +124,12 @@ var decryptPKCS1v15SessionKeyTests = []DecryptPKCS1v15Test{ func TestEncryptPKCS1v15SessionKey(t *testing.T) { for i, test := range decryptPKCS1v15SessionKeyTests { - key := strings.Bytes("FAIL") + key := []byte("FAIL") err := DecryptPKCS1v15SessionKey(nil, rsaPrivateKey, decodeBase64(test.in), key) if err != nil { t.Errorf("#%d error decrypting", i) } - want := strings.Bytes(test.out) + want := []byte(test.out) if bytes.Compare(key, want) != 0 { t.Errorf("#%d got:%#v want:%#v", i, key, want) } @@ -169,7 +168,7 @@ var signPKCS1v15Tests = []signPKCS1v15Test{ func TestSignPKCS1v15(t *testing.T) { for i, test := range signPKCS1v15Tests { h := sha1.New() - h.Write(strings.Bytes(test.in)) + h.Write([]byte(test.in)) digest := h.Sum() s, err := SignPKCS1v15(nil, rsaPrivateKey, HashSHA1, digest) @@ -187,7 +186,7 @@ func TestSignPKCS1v15(t *testing.T) { func TestVerifyPKCS1v15(t *testing.T) { for i, test := range signPKCS1v15Tests { h := sha1.New() - h.Write(strings.Bytes(test.in)) + h.Write([]byte(test.in)) digest := h.Sum() sig, _ := hex.DecodeString(test.out) diff --git a/src/pkg/crypto/tls/handshake_messages.go b/src/pkg/crypto/tls/handshake_messages.go index 10d2ba3e26..966314857f 100644 --- a/src/pkg/crypto/tls/handshake_messages.go +++ b/src/pkg/crypto/tls/handshake_messages.go @@ -4,8 +4,6 @@ package tls -import "strings" - type clientHelloMsg struct { raw []byte major, minor uint8 @@ -100,7 +98,7 @@ func (m *clientHelloMsg) marshal() []byte { z[1] = 1 z[3] = byte(len(m.serverName) >> 8) z[4] = byte(len(m.serverName)) - copy(z[5:], strings.Bytes(m.serverName)) + copy(z[5:], []byte(m.serverName)) z = z[l:] } @@ -280,7 +278,7 @@ func (m *serverHelloMsg) marshal() []byte { l = 255 } z[0] = byte(l) - copy(z[1:], strings.Bytes(v[0:l])) + copy(z[1:], []byte(v[0:l])) z = z[1+l:] } } @@ -548,7 +546,7 @@ func (m *nextProtoMsg) marshal() []byte { y := x[4:] y[0] = byte(l) - copy(y[1:], strings.Bytes(m.proto[0:l])) + copy(y[1:], []byte(m.proto[0:l])) y = y[1+l:] y[0] = byte(padding) diff --git a/src/pkg/crypto/tls/prf.go b/src/pkg/crypto/tls/prf.go index 6b9c44c077..ee6cb780b4 100644 --- a/src/pkg/crypto/tls/prf.go +++ b/src/pkg/crypto/tls/prf.go @@ -10,7 +10,6 @@ import ( "crypto/sha1" "hash" "os" - "strings" ) // Split a premaster secret in two as specified in RFC 4346, section 5. @@ -70,10 +69,10 @@ const ( finishedVerifyLength = 12 // Length of verify_data in a Finished message. ) -var masterSecretLabel = strings.Bytes("master secret") -var keyExpansionLabel = strings.Bytes("key expansion") -var clientFinishedLabel = strings.Bytes("client finished") -var serverFinishedLabel = strings.Bytes("server finished") +var masterSecretLabel = []byte("master secret") +var keyExpansionLabel = []byte("key expansion") +var clientFinishedLabel = []byte("client finished") +var serverFinishedLabel = []byte("server finished") // keysFromPreMasterSecret generates the connection keys from the pre master // secret, given the lengths of the MAC and cipher keys, as defined in RFC diff --git a/src/pkg/crypto/x509/x509.go b/src/pkg/crypto/x509/x509.go index f486a5a68e..5b526de4d9 100644 --- a/src/pkg/crypto/x509/x509.go +++ b/src/pkg/crypto/x509/x509.go @@ -735,7 +735,7 @@ func buildExtensions(template *Certificate) (ret []extension, err os.Error) { ret[n].Id = oidExtensionSubjectAltName rawValues := make([]asn1.RawValue, len(template.DNSNames)) for i, name := range template.DNSNames { - rawValues[i] = asn1.RawValue{Tag: 2, Class: 2, Bytes: strings.Bytes(name)} + rawValues[i] = asn1.RawValue{Tag: 2, Class: 2, Bytes: []byte(name)} } ret[n].Value, err = asn1.MarshalToMemory(rawValues) if err != nil { diff --git a/src/pkg/crypto/x509/x509_test.go b/src/pkg/crypto/x509/x509_test.go index 49560267b7..e0ae37736e 100644 --- a/src/pkg/crypto/x509/x509_test.go +++ b/src/pkg/crypto/x509/x509_test.go @@ -11,13 +11,12 @@ import ( "encoding/pem" "os" "reflect" - "strings" "testing" "time" ) func TestParsePKCS1PrivateKey(t *testing.T) { - block, _ := pem.Decode(strings.Bytes(pemPrivateKey)) + block, _ := pem.Decode([]byte(pemPrivateKey)) priv, err := ParsePKCS1PrivateKey(block.Bytes) if err != nil { t.Errorf("Failed to parse private key: %s", err) @@ -151,7 +150,7 @@ func TestCreateSelfSignedCertificate(t *testing.T) { t.Errorf("failed to open /dev/urandom") } - block, _ := pem.Decode(strings.Bytes(pemPrivateKey)) + block, _ := pem.Decode([]byte(pemPrivateKey)) priv, err := ParsePKCS1PrivateKey(block.Bytes) if err != nil { t.Errorf("Failed to parse private key: %s", err) diff --git a/src/pkg/ebnf/ebnf_test.go b/src/pkg/ebnf/ebnf_test.go index e6f670530d..a88d19bed8 100644 --- a/src/pkg/ebnf/ebnf_test.go +++ b/src/pkg/ebnf/ebnf_test.go @@ -6,7 +6,6 @@ package ebnf import ( "io/ioutil" - "strings" "testing" ) @@ -53,7 +52,7 @@ func check(t *testing.T, filename string, src []byte) { func TestGrammars(t *testing.T) { for _, src := range grammars { - check(t, "", strings.Bytes(src)) + check(t, "", []byte(src)) } } diff --git a/src/pkg/encoding/ascii85/ascii85_test.go b/src/pkg/encoding/ascii85/ascii85_test.go index 3219d49e0f..738e1cc1bd 100644 --- a/src/pkg/encoding/ascii85/ascii85_test.go +++ b/src/pkg/encoding/ascii85/ascii85_test.go @@ -8,7 +8,6 @@ import ( "bytes" "io/ioutil" "os" - "strings" "testing" ) @@ -57,7 +56,7 @@ func strip85(s string) string { func TestEncode(t *testing.T) { for _, p := range pairs { buf := make([]byte, MaxEncodedLen(len(p.decoded))) - n := Encode(buf, strings.Bytes(p.decoded)) + n := Encode(buf, []byte(p.decoded)) buf = buf[0:n] testEqual(t, "Encode(%q) = %q, want %q", p.decoded, strip85(string(buf)), strip85(p.encoded)) } @@ -67,14 +66,14 @@ func TestEncoder(t *testing.T) { for _, p := range pairs { bb := &bytes.Buffer{} encoder := NewEncoder(bb) - encoder.Write(strings.Bytes(p.decoded)) + encoder.Write([]byte(p.decoded)) encoder.Close() testEqual(t, "Encode(%q) = %q, want %q", p.decoded, strip85(bb.String()), strip85(p.encoded)) } } func TestEncoderBuffering(t *testing.T) { - input := strings.Bytes(bigtest.decoded) + input := []byte(bigtest.decoded) for bs := 1; bs <= 12; bs++ { bb := &bytes.Buffer{} encoder := NewEncoder(bb) @@ -96,7 +95,7 @@ func TestEncoderBuffering(t *testing.T) { func TestDecode(t *testing.T) { for _, p := range pairs { dbuf := make([]byte, 4*len(p.encoded)) - ndst, nsrc, err := Decode(dbuf, strings.Bytes(p.encoded), true) + ndst, nsrc, err := Decode(dbuf, []byte(p.encoded), true) testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil)) testEqual(t, "Decode(%q) = nsrc %v, want %v", p.encoded, nsrc, len(p.encoded)) testEqual(t, "Decode(%q) = ndst %v, want %v", p.encoded, ndst, len(p.decoded)) @@ -145,7 +144,7 @@ func TestDecodeCorrupt(t *testing.T) { for _, e := range examples { dbuf := make([]byte, 4*len(e.e)) - _, _, err := Decode(dbuf, strings.Bytes(e.e), true) + _, _, err := Decode(dbuf, []byte(e.e), true) switch err := err.(type) { case CorruptInputError: testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p) diff --git a/src/pkg/encoding/base64/base64_test.go b/src/pkg/encoding/base64/base64_test.go index f26f8f2ce5..c14785f1b4 100644 --- a/src/pkg/encoding/base64/base64_test.go +++ b/src/pkg/encoding/base64/base64_test.go @@ -8,7 +8,6 @@ import ( "bytes" "io/ioutil" "os" - "strings" "testing" ) @@ -58,7 +57,7 @@ func testEqual(t *testing.T, msg string, args ...interface{}) bool { func TestEncode(t *testing.T) { for _, p := range pairs { buf := make([]byte, StdEncoding.EncodedLen(len(p.decoded))) - StdEncoding.Encode(buf, strings.Bytes(p.decoded)) + StdEncoding.Encode(buf, []byte(p.decoded)) testEqual(t, "Encode(%q) = %q, want %q", p.decoded, string(buf), p.encoded) } } @@ -67,14 +66,14 @@ func TestEncoder(t *testing.T) { for _, p := range pairs { bb := &bytes.Buffer{} encoder := NewEncoder(StdEncoding, bb) - encoder.Write(strings.Bytes(p.decoded)) + encoder.Write([]byte(p.decoded)) encoder.Close() testEqual(t, "Encode(%q) = %q, want %q", p.decoded, bb.String(), p.encoded) } } func TestEncoderBuffering(t *testing.T) { - input := strings.Bytes(bigtest.decoded) + input := []byte(bigtest.decoded) for bs := 1; bs <= 12; bs++ { bb := &bytes.Buffer{} encoder := NewEncoder(StdEncoding, bb) @@ -96,7 +95,7 @@ func TestEncoderBuffering(t *testing.T) { func TestDecode(t *testing.T) { for _, p := range pairs { dbuf := make([]byte, StdEncoding.DecodedLen(len(p.encoded))) - count, end, err := StdEncoding.decode(dbuf, strings.Bytes(p.encoded)) + count, end, err := StdEncoding.decode(dbuf, []byte(p.encoded)) testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil)) testEqual(t, "Decode(%q) = length %v, want %v", p.encoded, count, len(p.decoded)) if len(p.encoded) > 0 { @@ -153,7 +152,7 @@ func TestDecodeCorrupt(t *testing.T) { for _, e := range examples { dbuf := make([]byte, StdEncoding.DecodedLen(len(e.e))) - _, err := StdEncoding.Decode(dbuf, strings.Bytes(e.e)) + _, err := StdEncoding.Decode(dbuf, []byte(e.e)) switch err := err.(type) { case CorruptInputError: testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p) diff --git a/src/pkg/encoding/git85/git_test.go b/src/pkg/encoding/git85/git_test.go index 0eb65129d3..a31f14d3cf 100644 --- a/src/pkg/encoding/git85/git_test.go +++ b/src/pkg/encoding/git85/git_test.go @@ -8,7 +8,6 @@ import ( "bytes" "io/ioutil" "os" - "strings" "testing" ) @@ -61,7 +60,7 @@ var gitBigtest = gitPairs[len(gitPairs)-1] func TestEncode(t *testing.T) { for _, p := range gitPairs { buf := make([]byte, EncodedLen(len(p.decoded))) - n := Encode(buf, strings.Bytes(p.decoded)) + n := Encode(buf, []byte(p.decoded)) if n != len(buf) { t.Errorf("EncodedLen does not agree with Encode") } @@ -74,14 +73,14 @@ func TestEncoder(t *testing.T) { for _, p := range gitPairs { bb := &bytes.Buffer{} encoder := NewEncoder(bb) - encoder.Write(strings.Bytes(p.decoded)) + encoder.Write([]byte(p.decoded)) encoder.Close() testEqual(t, "Encode(%q) = %q, want %q", p.decoded, bb.String(), p.encoded) } } func TestEncoderBuffering(t *testing.T) { - input := strings.Bytes(gitBigtest.decoded) + input := []byte(gitBigtest.decoded) for bs := 1; bs <= 12; bs++ { bb := &bytes.Buffer{} encoder := NewEncoder(bb) @@ -103,7 +102,7 @@ func TestEncoderBuffering(t *testing.T) { func TestDecode(t *testing.T) { for _, p := range gitPairs { dbuf := make([]byte, 4*len(p.encoded)) - ndst, err := Decode(dbuf, strings.Bytes(p.encoded)) + ndst, err := Decode(dbuf, []byte(p.encoded)) testEqual(t, "Decode(%q) = error %v, want %v", p.encoded, err, os.Error(nil)) testEqual(t, "Decode(%q) = ndst %v, want %v", p.encoded, ndst, len(p.decoded)) testEqual(t, "Decode(%q) = %q, want %q", p.encoded, string(dbuf[0:ndst]), p.decoded) @@ -151,7 +150,7 @@ func TestDecodeCorrupt(t *testing.T) { for _, e := range examples { dbuf := make([]byte, 2*len(e.e)) - _, err := Decode(dbuf, strings.Bytes(e.e)) + _, err := Decode(dbuf, []byte(e.e)) switch err := err.(type) { case CorruptInputError: testEqual(t, "Corruption in %q at offset %v, want %v", e.e, int(err), e.p) diff --git a/src/pkg/encoding/hex/hex.go b/src/pkg/encoding/hex/hex.go index 8a9271c237..1c52885e2e 100644 --- a/src/pkg/encoding/hex/hex.go +++ b/src/pkg/encoding/hex/hex.go @@ -8,7 +8,6 @@ package hex import ( "os" "strconv" - "strings" ) const hextable = "0123456789abcdef" @@ -92,7 +91,7 @@ func EncodeToString(src []byte) string { // DecodeString returns the bytes represented by the hexadecimal string s. func DecodeString(s string) ([]byte, os.Error) { - src := strings.Bytes(s) + src := []byte(s) dst := make([]byte, DecodedLen(len(src))) _, err := Decode(dst, src) if err != nil { diff --git a/src/pkg/encoding/pem/pem.go b/src/pkg/encoding/pem/pem.go index 6ef8f86612..359fe7d515 100644 --- a/src/pkg/encoding/pem/pem.go +++ b/src/pkg/encoding/pem/pem.go @@ -12,7 +12,6 @@ import ( "encoding/base64" "io" "os" - "strings" ) // A Block represents a PEM encoded structure. @@ -65,9 +64,9 @@ func removeWhitespace(data []byte) []byte { return result[0:n] } -var pemStart = strings.Bytes("\n-----BEGIN ") -var pemEnd = strings.Bytes("\n-----END ") -var pemEndOfLine = strings.Bytes("-----") +var pemStart = []byte("\n-----BEGIN ") +var pemEnd = []byte("\n-----END ") +var pemEndOfLine = []byte("-----") // Decode will find the next PEM formatted block (certificate, private key // etc) in the input. It returns that block and the remainder of the input. If @@ -214,13 +213,13 @@ func Encode(out io.Writer, b *Block) (err os.Error) { if err != nil { return } - _, err = out.Write(strings.Bytes(b.Type + "-----\n")) + _, err = out.Write([]byte(b.Type + "-----\n")) if err != nil { return } for k, v := range b.Headers { - _, err = out.Write(strings.Bytes(k + ": " + v + "\n")) + _, err = out.Write([]byte(k + ": " + v + "\n")) if err != nil { return } @@ -248,7 +247,7 @@ func Encode(out io.Writer, b *Block) (err os.Error) { if err != nil { return } - _, err = out.Write(strings.Bytes(b.Type + "-----\n")) + _, err = out.Write([]byte(b.Type + "-----\n")) return } diff --git a/src/pkg/encoding/pem/pem_test.go b/src/pkg/encoding/pem/pem_test.go index c3afbd2fd2..42bd573d70 100644 --- a/src/pkg/encoding/pem/pem_test.go +++ b/src/pkg/encoding/pem/pem_test.go @@ -7,7 +7,6 @@ package pem import ( "bytes" "reflect" - "strings" "testing" ) @@ -28,7 +27,7 @@ var getLineTests = []GetLineTest{ func TestGetLine(t *testing.T) { for i, test := range getLineTests { - x, y := getLine(strings.Bytes(test.in)) + x, y := getLine([]byte(test.in)) if string(x) != test.out1 || string(y) != test.out2 { t.Errorf("#%d got:%+v,%+v want:%s,%s", i, x, y, test.out1, test.out2) } @@ -36,7 +35,7 @@ func TestGetLine(t *testing.T) { } func TestDecode(t *testing.T) { - result, remainder := Decode(strings.Bytes(pemData)) + result, remainder := Decode([]byte(pemData)) if !reflect.DeepEqual(result, certificate) { t.Errorf("#0 got:%#v want:%#v", result, certificate) } @@ -44,7 +43,7 @@ func TestDecode(t *testing.T) { if !reflect.DeepEqual(result, privateKey) { t.Errorf("#1 got:%#v want:%#v", result, privateKey) } - result, _ = Decode(strings.Bytes(pemPrivateKey)) + result, _ = Decode([]byte(pemPrivateKey)) if !reflect.DeepEqual(result, privateKey2) { t.Errorf("#2 got:%#v want:%#v", result, privateKey2) } @@ -77,7 +76,7 @@ func TestLineBreaker(t *testing.T) { buf := bytes.NewBuffer(nil) var breaker lineBreaker breaker.out = buf - _, err := breaker.Write(strings.Bytes(test.in)) + _, err := breaker.Write([]byte(test.in)) if err != nil { t.Errorf("#%d: error from Write: %s", i, err) continue @@ -99,7 +98,7 @@ func TestLineBreaker(t *testing.T) { breaker.out = buf for i := 0; i < len(test.in); i++ { - _, err := breaker.Write(strings.Bytes(test.in[i : i+1])) + _, err := breaker.Write([]byte(test.in[i : i+1])) if err != nil { t.Errorf("#%d: error from Write (byte by byte): %s", i, err) continue diff --git a/src/pkg/exp/datafmt/datafmt_test.go b/src/pkg/exp/datafmt/datafmt_test.go index d1c6222a0d..b109bca6e0 100644 --- a/src/pkg/exp/datafmt/datafmt_test.go +++ b/src/pkg/exp/datafmt/datafmt_test.go @@ -6,13 +6,12 @@ package datafmt import ( "fmt" - "strings" "testing" ) func parse(t *testing.T, form string, fmap FormatterMap) Format { - f, err := Parse("", strings.Bytes(form), fmap) + f, err := Parse("", []byte(form), fmap) if err != nil { t.Errorf("Parse(%s): %v", form, err) return nil @@ -52,7 +51,7 @@ func formatter(s *State, value interface{}, rule_name string) bool { case "nil": return false case "testing.T": - s.Write(strings.Bytes("testing.T")) + s.Write([]byte("testing.T")) return true } panic("unreachable") diff --git a/src/pkg/exp/datafmt/parser.go b/src/pkg/exp/datafmt/parser.go index 6537716745..de1f1c2a6b 100644 --- a/src/pkg/exp/datafmt/parser.go +++ b/src/pkg/exp/datafmt/parser.go @@ -137,7 +137,7 @@ func (p *parser) parseString() string { func (p *parser) parseLiteral() literal { - s := strings.Bytes(p.parseString()) + s := []byte(p.parseString()) // A string literal may contain %-format specifiers. To simplify // and speed up printing of the literal, split it into segments diff --git a/src/pkg/exp/spacewar/spacewar.go b/src/pkg/exp/spacewar/spacewar.go index a86aa7f247..93cbe84886 100644 --- a/src/pkg/exp/spacewar/spacewar.go +++ b/src/pkg/exp/spacewar/spacewar.go @@ -32,7 +32,6 @@ import ( "log" "os" "runtime" - "strings" "time" "./pdp1" ) @@ -53,7 +52,7 @@ func main() { var m SpacewarPDP1 m.Init(w) m.PC = 4 - f := bytes.NewBuffer(strings.Bytes(spacewarCode)) + f := bytes.NewBuffer([]byte(spacewarCode)) if err = m.Load(f); err != nil { log.Exitf("loading %s: %s", "spacewar.lst", err) } diff --git a/src/pkg/fmt/fmt_test.go b/src/pkg/fmt/fmt_test.go index 139036eb37..b54c25899f 100644 --- a/src/pkg/fmt/fmt_test.go +++ b/src/pkg/fmt/fmt_test.go @@ -66,12 +66,12 @@ var fmttests = []fmtTest{ fmtTest{"%q", "abc", `"abc"`}, // basic bytes - fmtTest{"%s", strings.Bytes("abc"), "abc"}, - fmtTest{"%x", strings.Bytes("abc"), "616263"}, - fmtTest{"% x", strings.Bytes("abc"), "61 62 63"}, - fmtTest{"%x", strings.Bytes("xyz"), "78797a"}, - fmtTest{"%X", strings.Bytes("xyz"), "78797A"}, - fmtTest{"%q", strings.Bytes("abc"), `"abc"`}, + fmtTest{"%s", []byte("abc"), "abc"}, + fmtTest{"%x", []byte("abc"), "616263"}, + fmtTest{"% x", []byte("abc"), "61 62 63"}, + fmtTest{"%x", []byte("xyz"), "78797a"}, + fmtTest{"%X", []byte("xyz"), "78797A"}, + fmtTest{"%q", []byte("abc"), `"abc"`}, // escaped strings fmtTest{"%#q", `abc`, "`abc`"}, diff --git a/src/pkg/go/doc/comment.go b/src/pkg/go/doc/comment.go index 09622f715b..6e9ad0b04c 100644 --- a/src/pkg/go/doc/comment.go +++ b/src/pkg/go/doc/comment.go @@ -123,8 +123,8 @@ func split(text []byte) [][]byte { var ( - ldquo = strings.Bytes("“") - rdquo = strings.Bytes("”") + ldquo = []byte("“") + rdquo = []byte("”") ) // Escape comment text for HTML. @@ -149,10 +149,10 @@ func commentEscape(w io.Writer, s []byte) { var ( - html_p = strings.Bytes("<p>\n") - html_endp = strings.Bytes("</p>\n") - html_pre = strings.Bytes("<pre>") - html_endpre = strings.Bytes("</pre>\n") + html_p = []byte("<p>\n") + html_endp = []byte("</p>\n") + html_pre = []byte("<pre>") + html_endpre = []byte("</pre>\n") ) diff --git a/src/pkg/go/parser/interface.go b/src/pkg/go/parser/interface.go index 931f03de67..fcaa3dfdff 100644 --- a/src/pkg/go/parser/interface.go +++ b/src/pkg/go/parser/interface.go @@ -15,7 +15,6 @@ import ( "io/ioutil" "os" pathutil "path" - "strings" ) @@ -27,7 +26,7 @@ func readSource(filename string, src interface{}) ([]byte, os.Error) { if src != nil { switch s := src.(type) { case string: - return strings.Bytes(s), nil + return []byte(s), nil case []byte: return s, nil case *bytes.Buffer: diff --git a/src/pkg/go/printer/nodes.go b/src/pkg/go/printer/nodes.go index f546f3f2a0..89b44f598c 100644 --- a/src/pkg/go/printer/nodes.go +++ b/src/pkg/go/printer/nodes.go @@ -12,7 +12,6 @@ import ( "bytes" "go/ast" "go/token" - "strings" ) @@ -286,7 +285,7 @@ func (p *printer) isOneLineFieldList(list []*ast.Field) bool { func (p *printer) setLineComment(text string) { - p.setComment(&ast.CommentGroup{[]*ast.Comment{&ast.Comment{noPos, strings.Bytes(text)}}}) + p.setComment(&ast.CommentGroup{[]*ast.Comment{&ast.Comment{noPos, []byte(text)}}}) } diff --git a/src/pkg/go/printer/printer.go b/src/pkg/go/printer/printer.go index 3db42e37b1..44bc3bb0ba 100644 --- a/src/pkg/go/printer/printer.go +++ b/src/pkg/go/printer/printer.go @@ -14,7 +14,6 @@ import ( "os" "reflect" "runtime" - "strings" "tabwriter" ) @@ -45,11 +44,11 @@ var ( newlines = [...]byte{'\n', '\n', '\n', '\n', '\n', '\n', '\n', '\n'} // more than maxNewlines formfeeds = [...]byte{'\f', '\f', '\f', '\f', '\f', '\f', '\f', '\f'} // more than maxNewlines - esc_quot = strings.Bytes(""") // shorter than """ - esc_apos = strings.Bytes("'") // shorter than "'" - esc_amp = strings.Bytes("&") - esc_lt = strings.Bytes("<") - esc_gt = strings.Bytes(">") + esc_quot = []byte(""") // shorter than """ + esc_apos = []byte("'") // shorter than "'" + esc_amp = []byte("&") + esc_lt = []byte("<") + esc_gt = []byte(">") ) @@ -223,12 +222,12 @@ func (p *printer) writeTaggedItem(data []byte, tag HTMLTag) { // write start tag, if any // (no html-escaping and no p.pos update for tags - use write0) if tag.Start != "" { - p.write0(strings.Bytes(tag.Start)) + p.write0([]byte(tag.Start)) } p.write(data) // write end tag, if any if tag.End != "" { - p.write0(strings.Bytes(tag.End)) + p.write0([]byte(tag.End)) } } @@ -247,7 +246,7 @@ func (p *printer) writeItem(pos token.Position, data []byte, tag HTMLTag) { } if debug { // do not update p.pos - use write0 - p.write0(strings.Bytes(fmt.Sprintf("[%d:%d]", pos.Line, pos.Column))) + p.write0([]byte(fmt.Sprintf("[%d:%d]", pos.Line, pos.Column))) } if p.Mode&GenHTML != 0 { // write line tag if on a new line @@ -744,7 +743,7 @@ func (p *printer) print(args ...) { if p.Styler != nil { data, tag = p.Styler.Ident(x) } else { - data = strings.Bytes(x.Name()) + data = []byte(x.Name()) } case *ast.BasicLit: if p.Styler != nil { @@ -756,12 +755,12 @@ func (p *printer) print(args ...) { // (note that valid Go programs cannot contain esc ('\xff') // bytes since they do not appear in legal UTF-8 sequences) // TODO(gri): do this more efficiently. - data = strings.Bytes("\xff" + string(data) + "\xff") + data = []byte("\xff" + string(data) + "\xff") case token.Token: if p.Styler != nil { data, tag = p.Styler.Token(x) } else { - data = strings.Bytes(x.String()) + data = []byte(x.String()) } isKeyword = x.IsKeyword() case token.Position: diff --git a/src/pkg/go/scanner/scanner_test.go b/src/pkg/go/scanner/scanner_test.go index 5a7828e68a..fe342bcdf2 100644 --- a/src/pkg/go/scanner/scanner_test.go +++ b/src/pkg/go/scanner/scanner_test.go @@ -7,7 +7,6 @@ package scanner import ( "go/token" "os" - "strings" "testing" ) @@ -225,7 +224,7 @@ func TestScan(t *testing.T) { // verify scan index := 0 epos := token.Position{"", 0, 1, 1} - nerrors := Tokenize("", strings.Bytes(src), &testErrorHandler{t}, ScanComments, + nerrors := Tokenize("", []byte(src), &testErrorHandler{t}, ScanComments, func(pos token.Position, tok token.Token, litb []byte) bool { e := elt{token.EOF, "", special} if index < len(tokens) { @@ -264,7 +263,7 @@ func TestScan(t *testing.T) { func checkSemi(t *testing.T, line string, mode uint) { var S Scanner - S.Init("TestSemis", strings.Bytes(line), nil, mode) + S.Init("TestSemis", []byte(line), nil, mode) pos, tok, lit := S.Scan() for tok != token.EOF { if tok == token.ILLEGAL { @@ -451,7 +450,7 @@ func TestLineComments(t *testing.T) { // verify scan var S Scanner - S.Init("TestLineComments", strings.Bytes(src), nil, 0) + S.Init("TestLineComments", []byte(src), nil, 0) for _, s := range segments { pos, _, lit := S.Scan() checkPos(t, string(lit), pos, token.Position{s.filename, pos.Offset, s.line, pos.Column}) @@ -468,7 +467,7 @@ func TestInit(t *testing.T) { var s Scanner // 1st init - s.Init("", strings.Bytes("if true { }"), nil, 0) + s.Init("", []byte("if true { }"), nil, 0) s.Scan() // if s.Scan() // true _, tok, _ := s.Scan() // { @@ -477,7 +476,7 @@ func TestInit(t *testing.T) { } // 2nd init - s.Init("", strings.Bytes("go true { ]"), nil, 0) + s.Init("", []byte("go true { ]"), nil, 0) _, tok, _ = s.Scan() // go if tok != token.GO { t.Errorf("bad token: got %s, expected %s", tok.String(), token.GO) @@ -493,7 +492,7 @@ func TestIllegalChars(t *testing.T) { var s Scanner const src = "*?*$*@*" - s.Init("", strings.Bytes(src), &testErrorHandler{t}, AllowIllegalChars) + s.Init("", []byte(src), &testErrorHandler{t}, AllowIllegalChars) for offs, ch := range src { pos, tok, lit := s.Scan() if pos.Offset != offs { @@ -521,7 +520,7 @@ func TestStdErrorHander(t *testing.T) { "@ @ @" // original file, line 1 again v := new(ErrorVector) - nerrors := Tokenize("File1", strings.Bytes(src), v, 0, + nerrors := Tokenize("File1", []byte(src), v, 0, func(pos token.Position, tok token.Token, litb []byte) bool { return tok != token.EOF }) @@ -567,7 +566,7 @@ func (h *errorCollector) Error(pos token.Position, msg string) { func checkError(t *testing.T, src string, tok token.Token, pos int, err string) { var s Scanner var h errorCollector - s.Init("", strings.Bytes(src), &h, ScanComments) + s.Init("", []byte(src), &h, ScanComments) _, tok0, _ := s.Scan() _, tok1, _ := s.Scan() if tok0 != tok { diff --git a/src/pkg/gob/codec_test.go b/src/pkg/gob/codec_test.go index 1c4fe1fc79..2ab46a7b0b 100644 --- a/src/pkg/gob/codec_test.go +++ b/src/pkg/gob/codec_test.go @@ -298,7 +298,7 @@ func TestScalarEncInstructions(t *testing.T) { // bytes == []uint8 { b.Reset() - data := struct{ a []byte }{strings.Bytes("hello")} + data := struct{ a []byte }{[]byte("hello")} instr := &encInstr{encUint8Array, 6, 0, 0} state := newencoderState(b) instr.op(instr, state, unsafe.Pointer(&data)) @@ -587,7 +587,7 @@ func TestEndToEnd(t *testing.T) { strs: &[2]string{s1, s2}, int64s: &[]int64{77, 89, 123412342134}, s: "Now is the time", - y: strings.Bytes("hello, sailor"), + y: []byte("hello, sailor"), t: &T2{"this is T2"}, } b := new(bytes.Buffer) @@ -935,7 +935,7 @@ func TestIgnoredFields(t *testing.T) { it0.ignore_e[2] = 3.0 it0.ignore_f = true it0.ignore_g = "pay no attention" - it0.ignore_h = strings.Bytes("to the curtain") + it0.ignore_h = []byte("to the curtain") it0.ignore_i = &RT1{3.1, "hi", 7, "hello"} b := new(bytes.Buffer) diff --git a/src/pkg/http/client.go b/src/pkg/http/client.go index 96bd4458ba..fe61d20733 100644 --- a/src/pkg/http/client.go +++ b/src/pkg/http/client.go @@ -46,7 +46,7 @@ func send(req *Request) (resp *Response, err os.Error) { if len(info) > 0 { enc := base64.URLEncoding encoded := make([]byte, enc.EncodedLen(len(info))) - enc.Encode(encoded, strings.Bytes(info)) + enc.Encode(encoded, []byte(info)) if req.Header == nil { req.Header = make(map[string]string) } diff --git a/src/pkg/http/lex.go b/src/pkg/http/lex.go index 46e0519576..d25c4e4038 100644 --- a/src/pkg/http/lex.go +++ b/src/pkg/http/lex.go @@ -4,10 +4,6 @@ package http -import ( - "strings" -) - // This file deals with lexical matters of HTTP func isSeparator(c byte) bool { @@ -112,7 +108,7 @@ func httpUnquote(raw []byte) (eaten int, result string) { // the input string might be parsed. result is always non-nil. func httpSplitFieldValue(fv string) (eaten int, result []string) { result = make([]string, 0, len(fv)) - raw := strings.Bytes(fv) + raw := []byte(fv) i := 0 chunk := "" for i < len(raw) { diff --git a/src/pkg/http/request.go b/src/pkg/http/request.go index 2110dfd525..9f18acb3b7 100644 --- a/src/pkg/http/request.go +++ b/src/pkg/http/request.go @@ -376,7 +376,7 @@ func CanonicalHeaderKey(s string) string { // and upper case after each dash. // (Host, User-Agent, If-Modified-Since). // HTTP headers are ASCII only, so no Unicode issues. - a := strings.Bytes(s) + a := []byte(s) upper := true for i, v := range a { if upper && 'a' <= v && v <= 'z' { diff --git a/src/pkg/http/url.go b/src/pkg/http/url.go index 40ea86549c..1f22bf30a1 100644 --- a/src/pkg/http/url.go +++ b/src/pkg/http/url.go @@ -70,7 +70,7 @@ func shouldEscape(c byte) bool { // CanonicalPath applies the algorithm specified in RFC 2396 to // simplify the path, removing unnecessary . and .. elements. func CanonicalPath(path string) string { - buf := strings.Bytes(path) + buf := []byte(path) a := buf[0:0] // state helps to find /.. ^.. ^. and /. patterns. // state == 1 - prev char is '/' or beginning of the string. diff --git a/src/pkg/io/io.go b/src/pkg/io/io.go index 4357d5c6fb..dcdc883b1b 100644 --- a/src/pkg/io/io.go +++ b/src/pkg/io/io.go @@ -8,10 +8,7 @@ // abstract the functionality, plus some other related primitives. package io -import ( - "os" - "strings" -) +import "os" // Error represents an unexpected I/O behavior. type Error struct { @@ -160,7 +157,7 @@ type ReadByter interface { // WriteString writes the contents of the string s to w, which accepts an array of bytes. func WriteString(w Writer, s string) (n int, err os.Error) { - return w.Write(strings.Bytes(s)) + return w.Write([]byte(s)) } // ReadAtLeast reads from r into buf until it has read at least min bytes. diff --git a/src/pkg/io/ioutil/ioutil_test.go b/src/pkg/io/ioutil/ioutil_test.go index 1deffe83eb..cc6075f9e6 100644 --- a/src/pkg/io/ioutil/ioutil_test.go +++ b/src/pkg/io/ioutil/ioutil_test.go @@ -7,7 +7,6 @@ package ioutil_test import ( . "io/ioutil" "os" - "strings" "testing" ) @@ -43,7 +42,7 @@ func TestWriteFile(t *testing.T) { "build bigger and better idiot-proof programs, and the Universe trying " + "to produce bigger and better idiots. So far, the Universe is winning." - if err := WriteFile(filename, strings.Bytes(data), 0644); err != nil { + if err := WriteFile(filename, []byte(data), 0644); err != nil { t.Fatalf("WriteFile %s: %v", filename, err) } diff --git a/src/pkg/io/pipe_test.go b/src/pkg/io/pipe_test.go index b0ee0f20b3..27eb061d48 100644 --- a/src/pkg/io/pipe_test.go +++ b/src/pkg/io/pipe_test.go @@ -8,7 +8,6 @@ import ( "fmt" . "io" "os" - "strings" "testing" "time" ) @@ -29,7 +28,7 @@ func TestPipe1(t *testing.T) { c := make(chan int) r, w := Pipe() var buf = make([]byte, 64) - go checkWrite(t, w, strings.Bytes("hello, world"), c) + go checkWrite(t, w, []byte("hello, world"), c) n, err := r.Read(buf) if err != nil { t.Errorf("read: %v", err) diff --git a/src/pkg/net/dialgoogle_test.go b/src/pkg/net/dialgoogle_test.go index dfcc8f01e3..03641817d0 100644 --- a/src/pkg/net/dialgoogle_test.go +++ b/src/pkg/net/dialgoogle_test.go @@ -7,7 +7,6 @@ package net import ( "flag" "io" - "strings" "syscall" "testing" ) @@ -18,7 +17,7 @@ var ipv6 = flag.Bool("ipv6", false, "assume ipv6 tunnel is present") // fd is already connected to the destination, port 80. // Run an HTTP request to fetch the appropriate page. func fetchGoogle(t *testing.T, fd Conn, network, addr string) { - req := strings.Bytes("GET /intl/en/privacy.html HTTP/1.0\r\nHost: www.google.com\r\n\r\n") + req := []byte("GET /intl/en/privacy.html HTTP/1.0\r\nHost: www.google.com\r\n\r\n") n, err := fd.Write(req) buf := make([]byte, 1000) diff --git a/src/pkg/net/server_test.go b/src/pkg/net/server_test.go index ae26e496a6..8e34945881 100644 --- a/src/pkg/net/server_test.go +++ b/src/pkg/net/server_test.go @@ -65,7 +65,7 @@ func connect(t *testing.T, network, addr string, isEmpty bool) { var b []byte if !isEmpty { - b = strings.Bytes("hello, world\n") + b = []byte("hello, world\n") } var b1 [100]byte diff --git a/src/pkg/os/os_test.go b/src/pkg/os/os_test.go index 4a84c4f18d..47661c44ad 100644 --- a/src/pkg/os/os_test.go +++ b/src/pkg/os/os_test.go @@ -468,7 +468,7 @@ func TestTruncate(t *testing.T) { } checkSize(t, Path, 0) - fd.Write(strings.Bytes("hello, world\n")) + fd.Write([]byte("hello, world\n")) checkSize(t, Path, 13) fd.Truncate(10) checkSize(t, Path, 10) @@ -476,7 +476,7 @@ func TestTruncate(t *testing.T) { checkSize(t, Path, 1024) fd.Truncate(0) checkSize(t, Path, 0) - fd.Write(strings.Bytes("surprise!")) + fd.Write([]byte("surprise!")) checkSize(t, Path, 13+9) // wrote at offset past where hello, world was. fd.Close() Remove(Path) @@ -688,7 +688,7 @@ func TestWriteAt(t *testing.T) { const data = "hello, world\n" io.WriteString(f, data) - n, err := f.WriteAt(strings.Bytes("WORLD"), 7) + n, err := f.WriteAt([]byte("WORLD"), 7) if err != nil || n != 5 { t.Fatalf("WriteAt 7: %d, %v", n, err) } diff --git a/src/pkg/patch/patch_test.go b/src/pkg/patch/patch_test.go index 49a5c76d45..afc0ea71c0 100644 --- a/src/pkg/patch/patch_test.go +++ b/src/pkg/patch/patch_test.go @@ -6,10 +6,7 @@ package patch // TODO(rsc): test Apply -import ( - "strings" - "testing" -) +import "testing" type Test struct { in string @@ -19,7 +16,7 @@ type Test struct { func TestFileApply(t *testing.T) { for i, test := range tests { - set, err := Parse(strings.Bytes(test.diff)) + set, err := Parse([]byte(test.diff)) if err != nil { t.Errorf("#%d: Parse: %s", i, err) continue @@ -28,7 +25,7 @@ func TestFileApply(t *testing.T) { t.Errorf("#%d: Parse returned %d patches, want 1", i, len(set.File)) continue } - new, err := set.File[0].Apply(strings.Bytes(test.in)) + new, err := set.File[0].Apply([]byte(test.in)) if err != nil { t.Errorf("#%d: Apply: %s", i, err) continue diff --git a/src/pkg/path/path.go b/src/pkg/path/path.go index c45f77be55..3ce2166e37 100644 --- a/src/pkg/path/path.go +++ b/src/pkg/path/path.go @@ -42,7 +42,7 @@ func Clean(path string) string { // writing to buf; w is index of next byte to write. // dotdot is index in buf where .. must stop, either because // it is the leading slash or it is a leading ../../.. prefix. - buf := strings.Bytes(path) + buf := []byte(path) r, w, dotdot := 0, 0, 0 if rooted { r, w, dotdot = 1, 1, 1 diff --git a/src/pkg/regexp/all_test.go b/src/pkg/regexp/all_test.go index 4570410f95..5b4d0ec126 100644 --- a/src/pkg/regexp/all_test.go +++ b/src/pkg/regexp/all_test.go @@ -161,7 +161,7 @@ func executeTest(t *testing.T, expr string, str string, match []int) { printVec(t, match) } // now try bytes - m = re.Execute(strings.Bytes(str)) + m = re.Execute([]byte(str)) if !equal(m, match) { t.Errorf("Execute failure on %#q matching %q:", expr, str) printVec(t, m) @@ -199,7 +199,7 @@ func matchTest(t *testing.T, expr string, str string, match []int) { t.Errorf("MatchString failure on %#q matching %q: %t should be %t", expr, str, m, len(match) > 0) } // now try bytes - m = re.Match(strings.Bytes(str)) + m = re.Match([]byte(str)) if m != (len(match) > 0) { t.Errorf("Match failure on %#q matching %q: %t should be %t", expr, str, m, len(match) > 0) } @@ -315,7 +315,7 @@ func TestReplaceAll(t *testing.T) { tc.pattern, tc.input, tc.replacement, actual, tc.output) } // now try bytes - actual = string(re.ReplaceAll(strings.Bytes(tc.input), strings.Bytes(tc.replacement))) + actual = string(re.ReplaceAll([]byte(tc.input), []byte(tc.replacement))) if actual != tc.output { t.Errorf("%q.Replace(%q,%q) = %q; want %q", tc.pattern, tc.input, tc.replacement, actual, tc.output) @@ -419,7 +419,7 @@ func TestAllMatches(t *testing.T) { case "matchit": result = make([]string, len(c.input)+1) i := 0 - b := strings.Bytes(c.input) + b := []byte(c.input) for match := range re.AllMatchesIter(b, c.n) { result[i] = string(match) i++ @@ -435,7 +435,7 @@ func TestAllMatches(t *testing.T) { result = result[0:i] case "match": result = make([]string, len(c.input)+1) - b := strings.Bytes(c.input) + b := []byte(c.input) i := 0 for _, match := range re.AllMatches(b, c.n) { result[i] = string(match) diff --git a/src/pkg/strings/strings.go b/src/pkg/strings/strings.go index eb2b7e09c6..80e8207951 100644 --- a/src/pkg/strings/strings.go +++ b/src/pkg/strings/strings.go @@ -302,23 +302,3 @@ func TrimSpace(s string) string { } return s[start:end] } - -// Bytes returns a new slice containing the bytes in s. -func Bytes(s string) []byte { - b := make([]byte, len(s)) - for i := 0; i < len(s); i++ { - b[i] = s[i] - } - return b -} - -// Runes returns a slice of runes (Unicode code points) equivalent to the string s. -func Runes(s string) []int { - t := make([]int, utf8.RuneCountInString(s)) - i := 0 - for _, r := range s { - t[i] = r - i++ - } - return t -} diff --git a/src/pkg/strings/strings_test.go b/src/pkg/strings/strings_test.go index 05df55ca94..a88f6aae4d 100644 --- a/src/pkg/strings/strings_test.go +++ b/src/pkg/strings/strings_test.go @@ -444,16 +444,16 @@ var RunesTests = []RunesTest{ func TestRunes(t *testing.T) { for _, tt := range RunesTests { - a := Runes(tt.in) + a := []int(tt.in) if !runesEqual(a, tt.out) { - t.Errorf("Runes(%q) = %v; want %v", tt.in, a, tt.out) + t.Errorf("[]int(%q) = %v; want %v", tt.in, a, tt.out) continue } if !tt.lossy { // can only test reassembly if we didn't lose information s := string(a) if s != tt.in { - t.Errorf("string(Runes(%q)) = %x; want %x", tt.in, s, tt.in) + t.Errorf("string([]int(%q)) = %x; want %x", tt.in, s, tt.in) } } } diff --git a/src/pkg/template/format.go b/src/pkg/template/format.go index dd49b1bb5a..717dcbdbb6 100644 --- a/src/pkg/template/format.go +++ b/src/pkg/template/format.go @@ -10,7 +10,6 @@ import ( "bytes" "fmt" "io" - "strings" ) // StringFormatter formats into the default string representation. @@ -26,11 +25,11 @@ func StringFormatter(w io.Writer, value interface{}, format string) { } var ( - esc_quot = strings.Bytes(""") // shorter than """ - esc_apos = strings.Bytes("'") // shorter than "'" - esc_amp = strings.Bytes("&") - esc_lt = strings.Bytes("<") - esc_gt = strings.Bytes(">") + esc_quot = []byte(""") // shorter than """ + esc_apos = []byte("'") // shorter than "'" + esc_amp = []byte("&") + esc_lt = []byte("<") + esc_gt = []byte(">") ) // HTMLEscape writes to w the properly escaped HTML equivalent diff --git a/src/pkg/template/template.go b/src/pkg/template/template.go index c32a742b87..40b9f640b7 100644 --- a/src/pkg/template/template.go +++ b/src/pkg/template/template.go @@ -915,7 +915,7 @@ func (t *Template) Parse(s string) os.Error { if !validDelim(t.ldelim) || !validDelim(t.rdelim) { return &Error{1, fmt.Sprintf("bad delimiter strings %q %q", t.ldelim, t.rdelim)} } - t.buf = strings.Bytes(s) + t.buf = []byte(s) t.p = 0 t.linenum = 1 t.parse() @@ -942,8 +942,8 @@ func (t *Template) Execute(data interface{}, wr io.Writer) os.Error { // delimiters are very rarely invalid and Parse has the necessary // error-handling interface already. func (t *Template) SetDelims(left, right string) { - t.ldelim = strings.Bytes(left) - t.rdelim = strings.Bytes(right) + t.ldelim = []byte(left) + t.rdelim = []byte(right) } // Parse creates a Template with default parameters (such as {} for diff --git a/src/pkg/template/template_test.go b/src/pkg/template/template_test.go index 460a3a4b1e..a7c34ebeea 100644 --- a/src/pkg/template/template_test.go +++ b/src/pkg/template/template_test.go @@ -9,7 +9,6 @@ import ( "container/vector" "fmt" "io" - "strings" "testing" ) @@ -397,7 +396,7 @@ func TestAll(t *testing.T) { s.stringmap = make(map[string]string) s.stringmap["stringkey1"] = "stringresult" // the same value so repeated section is order-independent s.stringmap["stringkey2"] = "stringresult" - s.bytes = strings.Bytes("hello") + s.bytes = []byte("hello") s.iface = []int{1, 2, 3} var buf bytes.Buffer diff --git a/src/pkg/testing/regexp_test.go b/src/pkg/testing/regexp_test.go index 51b632ee25..ffeb62b5bb 100644 --- a/src/pkg/testing/regexp_test.go +++ b/src/pkg/testing/regexp_test.go @@ -4,10 +4,6 @@ package testing -import ( - "strings" -) - var good_re = []string{ ``, `.`, @@ -179,7 +175,7 @@ func executeTest(t *T, expr string, str string, match []int) { printVec(t, match) } // now try bytes - m = re.Execute(strings.Bytes(str)) + m = re.Execute([]byte(str)) if !equal(m, match) { t.Error("Execute failure on `", expr, "` matching `", str, "`:") printVec(t, m) @@ -217,7 +213,7 @@ func matchTest(t *T, expr string, str string, match []int) { t.Error("MatchString failure on `", expr, "` matching `", str, "`:", m, "should be", len(match) > 0) } // now try bytes - m = re.Match(strings.Bytes(str)) + m = re.Match([]byte(str)) if m != (len(match) > 0) { t.Error("Match failure on `", expr, "` matching `", str, "`:", m, "should be", len(match) > 0) } @@ -247,7 +243,7 @@ func matchStringsTest(t *T, expr string, str string, match []int) { printStrings(t, strs) } // now try bytes - s := re.MatchSlices(strings.Bytes(str)) + s := re.MatchSlices([]byte(str)) if !equalBytes(s, strs) { t.Error("MatchSlices failure on `", expr, "` matching `", str, "`:") printBytes(t, s) diff --git a/src/pkg/utf8/utf8_test.go b/src/pkg/utf8/utf8_test.go index 68bfa6a772..460fdb543c 100644 --- a/src/pkg/utf8/utf8_test.go +++ b/src/pkg/utf8/utf8_test.go @@ -6,7 +6,6 @@ package utf8_test import ( "bytes" - "strings" "testing" . "utf8" ) @@ -48,7 +47,7 @@ var utf8map = []Utf8Map{ // strings.Bytes with one extra byte at end func makeBytes(s string) []byte { s += "\x00" - b := strings.Bytes(s) + b := []byte(s) return b[0 : len(s)-1] } @@ -214,7 +213,7 @@ func BenchmarkDecodeASCIIRune(b *testing.B) { } func BenchmarkDecodeJapaneseRune(b *testing.B) { - nihon := strings.Bytes("本") + nihon := []byte("本") for i := 0; i < b.N; i++ { DecodeRune(nihon) } diff --git a/src/pkg/websocket/websocket_test.go b/src/pkg/websocket/websocket_test.go index c15c435385..44fda8aaaf 100644 --- a/src/pkg/websocket/websocket_test.go +++ b/src/pkg/websocket/websocket_test.go @@ -12,7 +12,6 @@ import ( "log" "net" "once" - "strings" "testing" ) @@ -45,7 +44,7 @@ func TestEcho(t *testing.T) { t.Errorf("WebSocket handshake error", err) return } - msg := strings.Bytes("hello, world\n") + msg := []byte("hello, world\n") if _, err := ws.Write(msg); err != nil { t.Errorf("Write: error %v", err) } diff --git a/src/pkg/xgb/xgb.go b/src/pkg/xgb/xgb.go index 3f6f0b0a68..4d8b923033 100644 --- a/src/pkg/xgb/xgb.go +++ b/src/pkg/xgb/xgb.go @@ -173,7 +173,7 @@ func (c *Conn) sendBytes(buf []byte) { c.sendPadding(len(buf)) } -func (c *Conn) sendString(str string) { c.sendBytes(strings.Bytes(str)) } +func (c *Conn) sendString(str string) { c.sendBytes([]byte(str)) } // sendUInt32s sends a list of 32-bit integers as variable length data. func (c *Conn) sendUInt32List(list []uint32) { @@ -318,7 +318,7 @@ func Dial(display string) (*Conn, os.Error) { put16(buf[6:], uint16(len(authName))) put16(buf[8:], uint16(len(authData))) put16(buf[10:], 0) - copy(buf[12:], strings.Bytes(authName)) + copy(buf[12:], []byte(authName)) copy(buf[12+pad(len(authName)):], authData) if _, err = c.conn.Write(buf); err != nil { return nil, err diff --git a/src/pkg/xml/xml.go b/src/pkg/xml/xml.go index 67cbb824f7..1ddb896dec 100644 --- a/src/pkg/xml/xml.go +++ b/src/pkg/xml/xml.go @@ -815,7 +815,7 @@ Input: p.err = SyntaxError("invalid character entity &" + s + ";") return nil } - p.buf.Write(strings.Bytes(text)) + p.buf.Write([]byte(text)) b0, b1 = 0, 0 continue Input } @@ -1508,11 +1508,11 @@ var htmlAutoClose = []string{ } var ( - esc_quot = strings.Bytes(""") // shorter than """ - esc_apos = strings.Bytes("'") // shorter than "'" - esc_amp = strings.Bytes("&") - esc_lt = strings.Bytes("<") - esc_gt = strings.Bytes(">") + esc_quot = []byte(""") // shorter than """ + esc_apos = []byte("'") // shorter than "'" + esc_amp = []byte("&") + esc_lt = []byte("<") + esc_gt = []byte(">") ) // Escape writes to w the properly escaped XML equivalent diff --git a/src/pkg/xml/xml_test.go b/src/pkg/xml/xml_test.go index 47a3db1e82..2bd084fd82 100644 --- a/src/pkg/xml/xml_test.go +++ b/src/pkg/xml/xml_test.go @@ -9,7 +9,6 @@ import ( "io" "os" "reflect" - "strings" "testing" ) @@ -30,69 +29,71 @@ const testInput = ` </body><!-- missing final newline -->` var rawTokens = []Token{ - CharData(strings.Bytes("\n")), - ProcInst{"xml", strings.Bytes(`version="1.0" encoding="UTF-8"`)}, - CharData(strings.Bytes("\n")), - Directive(strings.Bytes(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" - "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`)), - CharData(strings.Bytes("\n")), + CharData([]byte("\n")), + ProcInst{"xml", []byte(`version="1.0" encoding="UTF-8"`)}, + CharData([]byte("\n")), + Directive([]byte(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" + "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`), + ), + CharData([]byte("\n")), StartElement{Name{"", "body"}, []Attr{Attr{Name{"xmlns", "foo"}, "ns1"}, Attr{Name{"", "xmlns"}, "ns2"}, Attr{Name{"xmlns", "tag"}, "ns3"}}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"", "hello"}, []Attr{Attr{Name{"", "lang"}, "en"}}}, - CharData(strings.Bytes("World <>'\" 白鵬翔")), + CharData([]byte("World <>'\" 白鵬翔")), EndElement{Name{"", "hello"}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"", "goodbye"}, nil}, EndElement{Name{"", "goodbye"}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"", "outer"}, []Attr{Attr{Name{"foo", "attr"}, "value"}, Attr{Name{"xmlns", "tag"}, "ns4"}}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"", "inner"}, nil}, EndElement{Name{"", "inner"}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), EndElement{Name{"", "outer"}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"tag", "name"}, nil}, - CharData(strings.Bytes("\n ")), - CharData(strings.Bytes("Some text here.")), - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), + CharData([]byte("Some text here.")), + CharData([]byte("\n ")), EndElement{Name{"tag", "name"}}, - CharData(strings.Bytes("\n")), + CharData([]byte("\n")), EndElement{Name{"", "body"}}, - Comment(strings.Bytes(" missing final newline ")), + Comment([]byte(" missing final newline ")), } var cookedTokens = []Token{ - CharData(strings.Bytes("\n")), - ProcInst{"xml", strings.Bytes(`version="1.0" encoding="UTF-8"`)}, - CharData(strings.Bytes("\n")), - Directive(strings.Bytes(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" - "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`)), - CharData(strings.Bytes("\n")), + CharData([]byte("\n")), + ProcInst{"xml", []byte(`version="1.0" encoding="UTF-8"`)}, + CharData([]byte("\n")), + Directive([]byte(`DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" + "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"`), + ), + CharData([]byte("\n")), StartElement{Name{"ns2", "body"}, []Attr{Attr{Name{"xmlns", "foo"}, "ns1"}, Attr{Name{"", "xmlns"}, "ns2"}, Attr{Name{"xmlns", "tag"}, "ns3"}}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"ns2", "hello"}, []Attr{Attr{Name{"", "lang"}, "en"}}}, - CharData(strings.Bytes("World <>'\" 白鵬翔")), + CharData([]byte("World <>'\" 白鵬翔")), EndElement{Name{"ns2", "hello"}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"ns2", "goodbye"}, nil}, EndElement{Name{"ns2", "goodbye"}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"ns2", "outer"}, []Attr{Attr{Name{"ns1", "attr"}, "value"}, Attr{Name{"xmlns", "tag"}, "ns4"}}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"ns2", "inner"}, nil}, EndElement{Name{"ns2", "inner"}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), EndElement{Name{"ns2", "outer"}}, - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), StartElement{Name{"ns3", "name"}, nil}, - CharData(strings.Bytes("\n ")), - CharData(strings.Bytes("Some text here.")), - CharData(strings.Bytes("\n ")), + CharData([]byte("\n ")), + CharData([]byte("Some text here.")), + CharData([]byte("\n ")), EndElement{Name{"ns3", "name"}}, - CharData(strings.Bytes("\n")), + CharData([]byte("\n")), EndElement{Name{"ns2", "body"}}, - Comment(strings.Bytes(" missing final newline ")), + Comment([]byte(" missing final newline ")), } var xmlInput = []string{ diff --git a/test/bench/chameneosredux.go b/test/bench/chameneosredux.go index 5445c42106..2cb1440041 100644 --- a/test/bench/chameneosredux.go +++ b/test/bench/chameneosredux.go @@ -123,7 +123,7 @@ func pallmall(cols []int) { fmt.Println(msg) tot := 0 // wait for all results - for _ = range (cols) { + for _ = range cols { result := <-ended tot += result.met fmt.Printf("%v%v\n", result.met, spell(result.same, true)) diff --git a/test/bench/fasta.go b/test/bench/fasta.go index 1afb1ffb80..f79ff680fb 100644 --- a/test/bench/fasta.go +++ b/test/bench/fasta.go @@ -41,7 +41,6 @@ import ( "bufio" "flag" "os" - "strings" ) var out *bufio.Writer @@ -161,7 +160,7 @@ func main() { AccumulateProbabilities(iub) AccumulateProbabilities(homosapiens) - alu := strings.Bytes( + alu := []byte( "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + diff --git a/test/bench/k-nucleotide.go b/test/bench/k-nucleotide.go index a5c7f79bb3..b4d4098d0d 100644 --- a/test/bench/k-nucleotide.go +++ b/test/bench/k-nucleotide.go @@ -42,7 +42,6 @@ import ( "io/ioutil" "os" "sort" - "strings" ) var in *bufio.Reader @@ -111,7 +110,7 @@ func print(m map[string]int) { func main() { in = bufio.NewReader(os.Stdin) - three := strings.Bytes(">THREE ") + three := []byte(">THREE ") for { line, err := in.ReadSlice('\n') if err != nil { diff --git a/test/bench/meteor-contest.go b/test/bench/meteor-contest.go index 163aaa7c45..6660810ebd 100644 --- a/test/bench/meteor-contest.go +++ b/test/bench/meteor-contest.go @@ -532,7 +532,7 @@ func calc_rows() { /* Calculate islands while solving the board. -*/ + */ func boardHasIslands(cell int8) int8 { /* Too low on board, don't bother checking */ if cell >= 40 { diff --git a/test/bench/regex-dna.go b/test/bench/regex-dna.go index 9d56830b36..22de2c6aae 100644 --- a/test/bench/regex-dna.go +++ b/test/bench/regex-dna.go @@ -40,7 +40,6 @@ import ( "io/ioutil" "os" "regexp" - "strings" ) var variants = []string{ @@ -101,7 +100,7 @@ func main() { fmt.Printf("%s %d\n", s, countMatches(s, bytes)) } for _, sub := range substs { - bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, strings.Bytes(sub.repl)) + bytes = regexp.MustCompile(sub.pat).ReplaceAll(bytes, []byte(sub.repl)) } fmt.Printf("\n%d\n%d\n%d\n", ilen, clen, len(bytes)) } |